sample_distance_ij#
- RNAdist.sampling.ed_sampling.sample_distance_ij(fc: RNA.fold_compound, i: int, j: int, nr_samples: int = 1000) float#
Samples structures redundantly and returns the approximated expected distance between nucleotide i and j.
Warning
Nucleotide indices are Zero based. This is in contrast to ViennaRNA
- Parameters:
fc (RNA.fold_compound) – ViennaRNA fold compound.
i (int) – nucleotide index of the first nt in the RNA string. Zero based.
j (int) – nucleotide index of the second nt in the RNA string. Zero based.
nr_samples (int) – Number of structures to draw for expected distance approximation
- Returns:
Approximated expected distance between nucleotides i and j.
- Return type:
float
>>> import RNA >>> seq = "GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA" >>> fc = RNA.fold_compound(seq, RNA.md(uniq_ML=1)) >>> sample_distance_ij(fc, 0, 20, nr_samples=10000) 16.19550000000088